Zingerone Alleviate Toxicity Induced by Cisplatin or Gamma Radiation in Rats by Modulating Pro-Inflammatory Mediators

Research | DOI: https://doi.org/10.31579/2640-1053/101

Zingerone Alleviate Toxicity Induced by Cisplatin or Gamma Radiation in Rats by Modulating Pro-Inflammatory Mediators

  • Gehan R. Abdel-Hamid* 1
  • Lobna A. Abdel-Aziz 2
  • Mona G. Anany 3

1 Radiation Biology Department, National Center for Radiation Research and Technology (NCRRT) - Egyptian Atomic Energy Authority (AEA), Cairo- Egypt.
2 Health Radiation Research Department, National Center for Radiation Research and Technology (NCRRT)-Atomic Energy Authority (AEA), Cairo. 
3 Faculty of Medicine for Girls, Al-Azhar University, Cairo. 

*Corresponding Author: Gehan R. Abdel-Hamid. Radiation Biology Department, National Center for Radiation Research and Technology (NCRRT)-Atomic Energy Authority (AEA), Cairo.

Citation: Gehan R. A-Hamid, Lobna A. A-Aziz, Mona G. Anany. (2021). Zingerone Alleviate Toxicity Induced by Cisplatin or Gamma Radiation in Rats by Modulating Pro-Inflammatory Mediators. Cancer Research and Cellular Therapeutics. 5(5); Doi:10.31579/2640-1053/101

Copyright: © 2021 Gehan R. Abdel-Hamid, This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Received: 23 October 2021 | Accepted: 30 October 2021 | Published: 05 November 2021

Keywords: cisplatin; radiation; zingerone; nf-κb; tnf-α; caspase-3

Abstract

Background: Zingerone is one of the active components of ginger that possesses multiple biological activities and anti-inflammatory properties against either radiation effect or cisplatin toxicity. 

Purpose: to examine the protective effect of zingerone against gamma radiation (IR) or cisplatin-induced immunotoxicity. 

Material and Methods: 48 rats were divided into six groups as follows: (group-1); normal control group received distilled water; (group-2); rats received Zingerone orally at a dose of 25 mg/kg b.wt. Once / day for 14 consecutive days (Zing.). (group-3); Rats were given a single injection of Cisplatin at a dose of 7.5 mg/kg b.wt. intraperitoneally (Cispl.).  (group-4); Rats exposed to a single dose of 6 Gy whole-body gamma irradiation using 137Cesium source in a Gamma cell 40 (Rad.). (group-5); rats received same dose of Zingerone then they were exposed to gamma radiation as in group 4 (Zing+Rad.). (group-6);   rats received Zingerone followed by single injection of Cisplatin at the dose of 7.5 mg/kg b.wt. Intraperitoneally (Zing+Cisp.).  

Results: Exhibited a significant increase in expression of NF-κB, IL-10, caspase-3, and gene expression of TNF-α as well as oxidative stress biomarkers (MDA and NO) levels accompanied with a reduced level of SOD in either whole body-irradiated or cisplatin-received group. Conversely, pro-inflammatory cytokines levels were significantly decreased with an improvement of oxidative stress in groups that received zingerone. 

Conclusion: It could be concluded that zingerone exerts its antioxidative activity and immunomodulatory effects through inhibition of pro-inflammatory mediators induced by whole body-gamma irradiation or cisplatin administration at two time interval early and late stage of radiation exposure (after 2 h and one week).Therefore, further studies are required to elucidate the molecular signaling pathway concerning zingerone.

Introduction

Although ionizing radiation has a therapeutic effect against solid tumors, it produces oxygen and nitrogen (ROS/RNS) which generate free radicals and produce toxic effects [1, 2]. In addition, severe complications may result from the combination of it with chemotherapy and it is restricted when large doses are required [3, 4].

Natural products have activities that help to protect against radiation exposure and drugs damage. In addition, they have anti-viral, anti-inflammatory, and anti-bacterial properties, as well as cancer prophylaxis [5-8]. Zingerone, an essential oil, extracted from natural product ginger that was reported to have various biological functions including antiapoptotic and antioxidant effects through interfering with the inflammatory pathway leading to a protective effect [9, 10].

Nuclear factor-kappa (NF-κB) ameliorates the activated B cells and plays an important role in deoxyribonucleic acid (DNA) transcription, cytokine generation and, cell survival. It controls the expression of a large number of genes involved in inflammation such as COX-2, VEGF (vascular endothelial growth Factor) pro-inflammatory cytokines (IL-1, IL-2, IL-6, and TNFα), chemokines ( IL-8, MIP-1α, and MCP-1), adhesion molecules, immuno-receptors, growth factors, and other agents involved in proliferation and invasion [11].

Severe oxidative stress resulted from exposure to ionizing radiation that generates a large number of reactive oxygen species (ROS) [12]. Free radical reactions are produced by lipid peroxidation which is a degenerative process that causes damages to the enzyme system and DNA. SOD prevents the formation of a new free radical and converts the existing one into less harmful molecules so participates in deletion and neutralization of toxic ROS. NO is an immune inflammatory factor expressed in response to interferon gamma (IFN-γ) [13-15].

Based on previous studies reported radioprotective effects of ginger essential oil (GEO) on irradiated mice, this study was undertaken to spotlight the activity of zingerone against cisplatin or gamma radiation-induced immunotoxicity and possibilities to be utilized pre- radio and chemotherapy.

Materials and methods

Chemicals

Zingerone and Cisplatin were obtained from (Sigma- Aldrich Chemical Co., St. Louis, MO, USA). Interleukin-10 (IL-10) (CAT# ab100764) and tumor necrosis factor-α (TNF-α) (CAT#ab236712)).  ELISA kits for rat (Abcam Co., Cambridge, MA). SYBR Green Master Mix (Applied Biosystems, Carlsbad, California).  NFKB western blot antibody Novus Biologicals, β-actin was obtained from Santa Cruz Biotechnology (Santa Cruz, California,USA). All the remaining chemicals and reagents were of the highest quality and analytical grade.

Radiation Facility

Male albino rats were exposed to 6 Gy whole-body gamma irradiation which was performed at NCRRT using Canadian Gamma cell-40 (Cs137), biological irradiator manufactured by Canada Ltd. Ottawa, Ontario, Canada. Animals were placed in a plastic sample tray with lid and supports provided for use in the sample cavity. The unit has ventilation holes which align with ventilation parts through the main shield to provide a means for uniform irradiation for small animals at a dose rate of 0.46 Gy/min at the time of experiment according to the guidelines of the Protection and Dosimetry Department. 

Animals

Male Swiss albino rats weighing (120-150 g) used in this study were supplied from the animal breeding house of the National Center for Radiation Research and Technology (NCRRT). Rats were acclimatized in the animal facility of NCRRT for at least one week before subjecting them to experimentation. Rats were kept under standard housing conditions of temperature (22–24 °C) and humidity (60 ± 10%) and a 12 h light/ dark cycle. Animals were fed a commercial standard pellet diet (containing necessary nutritive elements 23% protein, 4.68

Experimental design

48 Male albino rats were maintained under standard environmental conditions, continually monitored for survival and clinical condition till the end of experiment. The study was conducted according to the Ethics Committee of the National Research Centre and in accordance with the recommendations for the proper care and use of laboratory animals (HIN publication No. 85-23, revised 1985). They were divided into six groups as follows: (group-1) (Cont.); normal control group received distilled water. (Group-2) (Zing.); rats received Zingerone (Sigma- Aldrich Chemical Co., St. Louis, MO, USA) orally at a dose of 25 mg/kg b.wt. Once/ day for 14 consecutive days 16. (Group-3) (Cispl.);  Rats were given a single injection of Cisplatin (Sigma- Aldrich Chemical Co., St. Louis, MO, USA) at a dose of 7.5 mg/kg b.wt. intraperitoneally. (group-4); rats exposed to a single dose of 6 Gy 17 whole-body gamma irradiation (Rad.). (Group-5) (Zing+Rad.); rats received Zingerone  once/ day for 14 consecutive days then immediately were exposed to gamma radiation (group-6) (Zing+Cisp.); rats received Zingerone once/ day for 14 consecutive days then at the end of Zing treatment followed by single intraperitoneal injection of Cisplatin at the dose of 7.5 mg/kg b.wt. All animals underwent careful observation along the experimental period. At the end of experiment, (after 2 hours and after one week of radiation exposure, two time intervals) rats were decapitated under gentle diethyl ether anesthesia and then sacrificed. Spleen was excised and collected from animals and stored at - 80°C.

Determination of the Oxidative Stress in splenic homogenate 

Part of the spleen was weighted and homogenized (10%) in cold 50 mmol/L phosphate-buffered saline, pH 7.4. The homogenate was centrifuged at 1200 g for 15 min at 4 °C, and the supernatant was used. Lipid peroxidation was measured in terms of malondialdehyde (MDA) that measured in spleen according to the method of Yoshioka et al. [18] through thiobarbituric acid assay to forming thiobarbituric acid reactive substances (TBARS). In this reaction one molecule of MDA reacts with two molecules of thiobarbituric acid (TBA) in an acidic medium with production of a pink color of TBA-MDA that is measured at 535 nm. 

Nitric oxide (NO) was measured according to the method of [19]. Nitric oxide  is  relatively unstable  in  the presence  of  molecular oxygen, with  an  apparent half-life of  approximately 3-5 sec and is rapidly oxidized to nitrite and nitrate,totally  designated as NOx. The  assay  determines total  nitrite/nitrate  level based  on  the reduction  of  any nitrate  level  to nitrite  by  vanadium, followed  by the  detection  of total  nitrite (intrinisic + nitrite  obtained  from reduction of  nitrate) by Griess  reagent. The Griess reaction entails  formation  of a  chromophore  from the diazotization of sulfanilamide  by  nitrite followed  by  coupling with bicycle  amines, such as N-1-naphthylethylenediamine. The chromophoric a zoderivative can be measured colorimetrically at 540 nm.

Superoxide dismutase activity is measured in tissue homogenate according to the method of Minami and Yoshikawa [20]. Superoxide dismutase (SOD) catalyzes the dismutation of the superoxide radical (O2-) into hydrogen peroxide (H2O2) and elemental oxygen (O2).

Equation

Superoxide ions, generated from auto-oxidation of pyrogallol, convert the nitro blue tetrazolium chloride (NBT) to NBT-diformazan which absorbs light at 550 nm. Superoxide dismutase reduces the superoxide ion concentration thereby lowering the rate of NBT-diformazan formation. The extent of reduction in the appearance of NBT-diformazan is a measure of SOD activity present in samples.

Determination of interleukin-10 and tumor necrosis factor--α assays 

The measurements of Interleukin-10 (IL-10) and tumor necrosis factor-α (TNF-α) were done, according to the instruction guidelines of the ELISA kits for rat   (Abcam Co., Cambridge, MA).

Detection of caspase-3 by quantitative real-time PCR (qRT-PCR)

Isolation of RNA and Reverse TranscriptionSpleen tissue (100 mg) was homogenized in 1ml TRIzol reagent (Invitrogen, U.S.A.) consequently incubated for 10 min at room temperature (RT). Samples were mixed with 0.2 ml chloroform and incubated for 3 min at RT, followed by centrifugation (12,000 g, 15 min). Isopropanol 0.5 ml was added to the isolated aqueous phase, samples were re-centrifuged (12,000 g, 10 min) and the resulting RNA pellet was washed with 75% ethanol and centrifuged again (7500 g, 5 min). The RNA pellets dissolved in diethylpyrocarbonate (DEPC) water, then incubated (55–60 °C, 10 min). Determination of the nucleic acids yield at 260 nm by a spectrophotometer was done.

 The synthesis of cDNA was performed using the Reverse Transcription System (Promega, Leiden, and The Netherlands). Reverse transcription of RNA to synthesize single-stranded complementary DNA (cDNA) was performed using Thermo Scientific™ RevertAid™ First Strand cDNA Synthesis Kit (Fermentus, Thermo Fisher Scientific Inc, UK) according to the manufacturer instructions.

Quantitative Real-Time PCR

qRT-PCR was performed using an optical 96-well plate with an ABI PRISM 7500 fast sequence detection system (Applied Biosystems, Carlsbad, California) using Power SYBR® Green PCR Master Mix (Applied Biosystems, USA.). Syber green (SYBR® Green) chemistry is a method for performing real-time PCR analysis. SYBR® Green dye binds the minor groove of double-stranded DNA. When SYBR® Green dye binds to double-stranded DNA, the intensity of the fluorescence increases. As more double-stranded amplicons are produced, SYBR® Green dye fluorescence increases. The Power SYBR® Green PCR Master Mix can detect as few as 1 to 10 copies of a target gene over a wide range of DNA template concentrations. Universal thermal cycling conditions (95 °C for 10 min, 40 cycles of 95 °C for 15 s and 60 °C for 60 s). Each 10 μl reaction contained 5 μl SYBR Green Master Mix (Applied Biosystems), 0.3 μl gene-specific forward and reverses primers (10 μM), 2.5 μl cDNA and 1.9 μl nuclease-free water.The sequences of PCR primer pairs, (forward 5CAAACCACCAAGTGGAGGAG3, Reverse3'GTGGGTGAGGAGCACGTAGT-5') and β-actin (forward 5ATTGTTACCAACTGGGACGACATG-3 Reverse 3'-GAAGTCTA GAGCAACATAGCACA-5) as housekeeping gene. A threshold cycle (Ct) value was used for calculating the fold change expression. 

Gel Electrophoresis

PCR product (10 μl) was analyzed on agarose gel 2% with ethidium bromide staining, visualized on ultraviolet transilluminator and semi-quantified by using a gel documentation system (Bio-Doc Analyze, Biometra, Germany). All values were normalized to the β-actin genes. The relative expression of the RT- PCR amplified products and the fold change in the target genes were determined by the ΔΔCt method This method calculates the relative expression rate of the gene of interest by calculating the difference in expression, expressed as cycle threshold (Ct) cycle, between the test gene and the reference gene (ΔCt) compared to that of the control samples (calibrator) (ΔΔCt) then calculating the fold induction using the formula 2- (ΔΔCt).

Western immunoblotting analysis of nuclear factor kappa- B

Spleen tissue NF-κB protein was extracted using TRIzol reagent and protein concentration was quantified according to [21], 20µg of protein per lane were separated with 10% SDS-PAGE and transferred onto PVDA membranes. Membranes were incubated at RT for 2 hours with blocking solution (5% nonfat dried milk in 10 mM TrisCl, pH 7.5, 100 mM NaCl, and 0.1% Tween 20), then incubated overnight at 4°C with 1:1000 diluted primary antibody towards NF-κB protein with β-actin as control. After washing 3 times in 10 mM Tris-Cl, pH 7.5, 100 mM NaCl, and 0.1% Tween 20, the membrane was incubated with the secondary monoclonal antibody (Cell Signaling Technologies, USA) conjugated to horseradish peroxidase at RT for 2 h, and then membranes were washed 4 times with the same washing buffer. The membrane was developed and visualized by chemiluminescence. The NF-κB protein was quantified by scanning a laser densitometer (Biomed Instrument Inc., USA).

Statistical analysis 

Data analyses were performed using the SPSS 23.0 software (SPSS Inc., Chicago, IL, USA). All analyses were used One-way ANOVA, all experimental values were shown the mean ± SD. p ≤ 0.05 was considered significant for all tests.

Results

The data presented in Table (1) showed that exposure to 6 Gy γ-radiations or injection with cisplatin resulted in a significant elevation at p≤0.05 in lipid peroxidation (MDA) levels and nitric oxide accompanied with a reduced level of SOD at all the time intervals examined compared to control group. Meanwhile, pre-administration of Zingerone attenuated and decreased the elevated levels of the oxidative stress markers (MDA and NO) along with enhancement in the SOD activity. 

Table 1: Effect of oral administration of zingerone on oxidative stress/ antioxidant Markers

All values are expressed as means ± SD. a Significant difference vs. control group at p≤0.05. b significant difference vs. zingerone group at p≤0.05. c Significant difference vs. Cisplatin group at p≤0.05. d Significant difference vs. Rad. group at p≤0.05 

The obtained data in Fig.1 revealed a significant increment at p≤0.05 in the pro-inflammatory mediator TNF-α, accompanied by a significant decrease in anti-inflammatory cytokine IL-10 in both cisplatin and gamma-irradiated groups at the two-time intervals compared to the control group. On the other hand, the administration of zingerone has an opposing effect throughout modulating the pro-inflammatory/ anti-inflammatory mediator.

Figure 1: Effect of oral administration of zingerone on inflammatory mediators.  All values are expressed as means ± SD. a Significant difference vs. control group. significant difference vs. zingerone group. c Significant difference vs. Cisplatin group.  d Significant difference vs. Rad. group (p≤0.05).

As shown in Fig. 2, overexpression of caspase-3 in the spleen tissues of rats injected with cisplatin or exposed to gamma radiation at the two-time intervals was detected compared to normal control group. Conversely, treatment with zingerone resulted in a significant decline at p≤0.05 in its expression which may be due to the anti-apoptotic effect.

Figure 2: Effect of oral administration of zingerone on caspase-3 expression.All values are expressed as means ± SD. a: Significant difference vs. control group. b: significant difference vs. zingerone group. c: Significant difference vs. cisplatin group.  d: Significant difference vs. Rad. group (p≤0.05)

NF-κB activation is required for pro-inflammatory responses and the most important providers of inflammatory molecules are NF-κB and TNF-α. The experimental data (Fig. 3) showed that cisplatin or gamma-irradiation induced markedly upregulation of NF-κB protein expression in comparison with the control group at the two-time intervals. In contrast, the administration of zingerone was significantly downregulated its expression at p≤0.05. 

Figure 3. Effect of oral administration of zingerone on NF-κB protein expression at the two-time intervals. All values are expressed as means ± SD. a Significant difference vs. control group. b significant difference vs. zingerone group. C Significant difference vs. cisplatin group. d Significant difference vs. Rad. group (p≤0.05).

Discussion

Exposure to ionizing radiation (IR) has occurred during radiology (diagnostic or interventional), radiotherapy and occupational exposure in the radiation field. High radiation doses cause death whereas sublethal doses may induce diverse diseases, such as cancer, cardiovas cular diseases and cataracts [22]. In addition, ionizing radiation may cause harm to normal tissue with many complications that affect biological and physiological systems so they should be protected [23, 24].

The immune response in the damaged tissues as a result of radiation and chemotherapy is mediated by inflammatory cytokines response (polypeptide). The present investigations showed a significant elevation of the pro-inflammatory mediators TNF-α, NF-κβ and caspase3 accompanied by a significant reduction of anti-inflammatory cytokine (IL-10) after treatment with cisplatin or radiation exposure. These results coincide with the findings of [25]. Who suggested that enhanced inflammation by cisplatin may induce apoptosis by promoting caspase3activation and increased TNF-α and IFN-γ levels with decreased IL-10 release. 

In the current study, prophylactic treatment of zingerone revealed an amelioration of the inflammatory responses caused by cisplatin with significantly decreased expression of both NFκB and TNF-α. In agreement with our study, previous reports suggested the zingerone inhibits colitis in rats by downregulating NF-kB activity, MAPK and IL10 signaling pathways [26, 27]. It was found to suppress the activity of both PPAR, and NF-kB [28]. 

Data of the present study, revealed high levels of MDA and NO accompanied by remarkable decreases of SOD, compared to the control status, reflecting the cisplatin toxicity, represented by depletion of the antioxidant system [29], and it has been supposed that cisplatin generates free radicals by interacting with DNA.   In agreement with this, previous studies reported that NFκB activation is crucial in the expression of pro-inflammatory cytokines like TNF-α and other conditions related to increased ROS generation. In addition, Genetic generation of potentially cell-damaging oxidative enzymes like NADP oxidase and iNOS is induced due to the stimulation of transcription factor NF-κB by TNF- α. Inhibitors of NFκB have shown to protects against cisplatin-induced toxicity [30-32].

Administration of zingerone before cisplatin treatment also attenuates damage induced by cisplatin treatment; a decrease of malondialdehyde with concurrent amelioration of antioxidant activities was remarkable by its protective effect [33-36]. This protective effect against cisplatin-induced toxicity probably might be through the attenuation of oxidative stress and inflammation. Besides, that it aids in maintaining antioxidant and suppresses activation of redox-active transcription factor NFκB [10].  

Pretreatment of whole body radiation-exposure group with ginger showed significant improvement of oxidative stress. This coincided with the study of [24] reported that radiation induced reduction in intestinal tissue antioxidant enzyme levels such as superoxide dismutase, catalase, glutathione peroxidase, and glutathione which was reversed following administration of ginger essential oil.

Conclusion

As mentioned, it can be concluded that zingerone has an ameliorative effect against oxidative stress induced by cisplatin or gamma radiation by modulating the inflammatory process and targeting the NF-kB pathway. Therefore, it is recommended to use zingerone as an adjuvant therapy to reduce the toxicity resulting from radiotherapy or chemotherapy. More investigations are required to know the exact mechanistic pathway.

Acknowledgements

Thanks to all the authors.

Conflicting Interests

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

References

Clearly Auctoresonline and particularly Psychology and Mental Health Care Journal is dedicated to improving health care services for individuals and populations. The editorial boards' ability to efficiently recognize and share the global importance of health literacy with a variety of stakeholders. Auctoresonline publishing platform can be used to facilitate of optimal client-based services and should be added to health care professionals' repertoire of evidence-based health care resources.

img

Virginia E. Koenig

Journal of Clinical Cardiology and Cardiovascular Intervention The submission and review process was adequate. However I think that the publication total value should have been enlightened in early fases. Thank you for all.

img

Delcio G Silva Junior

Journal of Women Health Care and Issues By the present mail, I want to say thank to you and tour colleagues for facilitating my published article. Specially thank you for the peer review process, support from the editorial office. I appreciate positively the quality of your journal.

img

Ziemlé Clément Méda

Journal of Clinical Research and Reports I would be very delighted to submit my testimonial regarding the reviewer board and the editorial office. The reviewer board were accurate and helpful regarding any modifications for my manuscript. And the editorial office were very helpful and supportive in contacting and monitoring with any update and offering help. It was my pleasure to contribute with your promising Journal and I am looking forward for more collaboration.

img

Mina Sherif Soliman Georgy

We would like to thank the Journal of Thoracic Disease and Cardiothoracic Surgery because of the services they provided us for our articles. The peer-review process was done in a very excellent time manner, and the opinions of the reviewers helped us to improve our manuscript further. The editorial office had an outstanding correspondence with us and guided us in many ways. During a hard time of the pandemic that is affecting every one of us tremendously, the editorial office helped us make everything easier for publishing scientific work. Hope for a more scientific relationship with your Journal.

img

Layla Shojaie

The peer-review process which consisted high quality queries on the paper. I did answer six reviewers’ questions and comments before the paper was accepted. The support from the editorial office is excellent.

img

Sing-yung Wu

Journal of Neuroscience and Neurological Surgery. I had the experience of publishing a research article recently. The whole process was simple from submission to publication. The reviewers made specific and valuable recommendations and corrections that improved the quality of my publication. I strongly recommend this Journal.

img

Orlando Villarreal

Dr. Katarzyna Byczkowska My testimonial covering: "The peer review process is quick and effective. The support from the editorial office is very professional and friendly. Quality of the Clinical Cardiology and Cardiovascular Interventions is scientific and publishes ground-breaking research on cardiology that is useful for other professionals in the field.

img

Katarzyna Byczkowska

Thank you most sincerely, with regard to the support you have given in relation to the reviewing process and the processing of my article entitled "Large Cell Neuroendocrine Carcinoma of The Prostate Gland: A Review and Update" for publication in your esteemed Journal, Journal of Cancer Research and Cellular Therapeutics". The editorial team has been very supportive.

img

Anthony Kodzo-Grey Venyo

Testimony of Journal of Clinical Otorhinolaryngology: work with your Reviews has been a educational and constructive experience. The editorial office were very helpful and supportive. It was a pleasure to contribute to your Journal.

img

Pedro Marques Gomes

Dr. Bernard Terkimbi Utoo, I am happy to publish my scientific work in Journal of Women Health Care and Issues (JWHCI). The manuscript submission was seamless and peer review process was top notch. I was amazed that 4 reviewers worked on the manuscript which made it a highly technical, standard and excellent quality paper. I appreciate the format and consideration for the APC as well as the speed of publication. It is my pleasure to continue with this scientific relationship with the esteem JWHCI.

img

Bernard Terkimbi Utoo

This is an acknowledgment for peer reviewers, editorial board of Journal of Clinical Research and Reports. They show a lot of consideration for us as publishers for our research article “Evaluation of the different factors associated with side effects of COVID-19 vaccination on medical students, Mutah university, Al-Karak, Jordan”, in a very professional and easy way. This journal is one of outstanding medical journal.

img

Prof Sherif W Mansour

Dear Hao Jiang, to Journal of Nutrition and Food Processing We greatly appreciate the efficient, professional and rapid processing of our paper by your team. If there is anything else we should do, please do not hesitate to let us know. On behalf of my co-authors, we would like to express our great appreciation to editor and reviewers.

img

Hao Jiang

As an author who has recently published in the journal "Brain and Neurological Disorders". I am delighted to provide a testimonial on the peer review process, editorial office support, and the overall quality of the journal. The peer review process at Brain and Neurological Disorders is rigorous and meticulous, ensuring that only high-quality, evidence-based research is published. The reviewers are experts in their fields, and their comments and suggestions were constructive and helped improve the quality of my manuscript. The review process was timely and efficient, with clear communication from the editorial office at each stage. The support from the editorial office was exceptional throughout the entire process. The editorial staff was responsive, professional, and always willing to help. They provided valuable guidance on formatting, structure, and ethical considerations, making the submission process seamless. Moreover, they kept me informed about the status of my manuscript and provided timely updates, which made the process less stressful. The journal Brain and Neurological Disorders is of the highest quality, with a strong focus on publishing cutting-edge research in the field of neurology. The articles published in this journal are well-researched, rigorously peer-reviewed, and written by experts in the field. The journal maintains high standards, ensuring that readers are provided with the most up-to-date and reliable information on brain and neurological disorders. In conclusion, I had a wonderful experience publishing in Brain and Neurological Disorders. The peer review process was thorough, the editorial office provided exceptional support, and the journal's quality is second to none. I would highly recommend this journal to any researcher working in the field of neurology and brain disorders.

img

Dr Shiming Tang

Dear Agrippa Hilda, Journal of Neuroscience and Neurological Surgery, Editorial Coordinator, I trust this message finds you well. I want to extend my appreciation for considering my article for publication in your esteemed journal. I am pleased to provide a testimonial regarding the peer review process and the support received from your editorial office. The peer review process for my paper was carried out in a highly professional and thorough manner. The feedback and comments provided by the authors were constructive and very useful in improving the quality of the manuscript. This rigorous assessment process undoubtedly contributes to the high standards maintained by your journal.

img

Raed Mualem

International Journal of Clinical Case Reports and Reviews. I strongly recommend to consider submitting your work to this high-quality journal. The support and availability of the Editorial staff is outstanding and the review process was both efficient and rigorous.

img

Andreas Filippaios

Thank you very much for publishing my Research Article titled “Comparing Treatment Outcome Of Allergic Rhinitis Patients After Using Fluticasone Nasal Spray And Nasal Douching" in the Journal of Clinical Otorhinolaryngology. As Medical Professionals we are immensely benefited from study of various informative Articles and Papers published in this high quality Journal. I look forward to enriching my knowledge by regular study of the Journal and contribute my future work in the field of ENT through the Journal for use by the medical fraternity. The support from the Editorial office was excellent and very prompt. I also welcome the comments received from the readers of my Research Article.

img

Dr Suramya Dhamija

Dear Erica Kelsey, Editorial Coordinator of Cancer Research and Cellular Therapeutics Our team is very satisfied with the processing of our paper by your journal. That was fast, efficient, rigorous, but without unnecessary complications. We appreciated the very short time between the submission of the paper and its publication on line on your site.

img

Bruno Chauffert

I am very glad to say that the peer review process is very successful and fast and support from the Editorial Office. Therefore, I would like to continue our scientific relationship for a long time. And I especially thank you for your kindly attention towards my article. Have a good day!

img

Baheci Selen

"We recently published an article entitled “Influence of beta-Cyclodextrins upon the Degradation of Carbofuran Derivatives under Alkaline Conditions" in the Journal of “Pesticides and Biofertilizers” to show that the cyclodextrins protect the carbamates increasing their half-life time in the presence of basic conditions This will be very helpful to understand carbofuran behaviour in the analytical, agro-environmental and food areas. We greatly appreciated the interaction with the editor and the editorial team; we were particularly well accompanied during the course of the revision process, since all various steps towards publication were short and without delay".

img

Jesus Simal-Gandara

I would like to express my gratitude towards you process of article review and submission. I found this to be very fair and expedient. Your follow up has been excellent. I have many publications in national and international journal and your process has been one of the best so far. Keep up the great work.

img

Douglas Miyazaki

We are grateful for this opportunity to provide a glowing recommendation to the Journal of Psychiatry and Psychotherapy. We found that the editorial team were very supportive, helpful, kept us abreast of timelines and over all very professional in nature. The peer review process was rigorous, efficient and constructive that really enhanced our article submission. The experience with this journal remains one of our best ever and we look forward to providing future submissions in the near future.

img

Dr Griffith

I am very pleased to serve as EBM of the journal, I hope many years of my experience in stem cells can help the journal from one way or another. As we know, stem cells hold great potential for regenerative medicine, which are mostly used to promote the repair response of diseased, dysfunctional or injured tissue using stem cells or their derivatives. I think Stem Cell Research and Therapeutics International is a great platform to publish and share the understanding towards the biology and translational or clinical application of stem cells.

img

Dr Tong Ming Liu

I would like to give my testimony in the support I have got by the peer review process and to support the editorial office where they were of asset to support young author like me to be encouraged to publish their work in your respected journal and globalize and share knowledge across the globe. I really give my great gratitude to your journal and the peer review including the editorial office.

img

Husain Taha Radhi

I am delighted to publish our manuscript entitled "A Perspective on Cocaine Induced Stroke - Its Mechanisms and Management" in the Journal of Neuroscience and Neurological Surgery. The peer review process, support from the editorial office, and quality of the journal are excellent. The manuscripts published are of high quality and of excellent scientific value. I recommend this journal very much to colleagues.

img

S Munshi

Dr.Tania Muñoz, My experience as researcher and author of a review article in The Journal Clinical Cardiology and Interventions has been very enriching and stimulating. The editorial team is excellent, performs its work with absolute responsibility and delivery. They are proactive, dynamic and receptive to all proposals. Supporting at all times the vast universe of authors who choose them as an option for publication. The team of review specialists, members of the editorial board, are brilliant professionals, with remarkable performance in medical research and scientific methodology. Together they form a frontline team that consolidates the JCCI as a magnificent option for the publication and review of high-level medical articles and broad collective interest. I am honored to be able to share my review article and open to receive all your comments.

img

Tania Munoz

“The peer review process of JPMHC is quick and effective. Authors are benefited by good and professional reviewers with huge experience in the field of psychology and mental health. The support from the editorial office is very professional. People to contact to are friendly and happy to help and assist any query authors might have. Quality of the Journal is scientific and publishes ground-breaking research on mental health that is useful for other professionals in the field”.

img

George Varvatsoulias

Dear editorial department: On behalf of our team, I hereby certify the reliability and superiority of the International Journal of Clinical Case Reports and Reviews in the peer review process, editorial support, and journal quality. Firstly, the peer review process of the International Journal of Clinical Case Reports and Reviews is rigorous, fair, transparent, fast, and of high quality. The editorial department invites experts from relevant fields as anonymous reviewers to review all submitted manuscripts. These experts have rich academic backgrounds and experience, and can accurately evaluate the academic quality, originality, and suitability of manuscripts. The editorial department is committed to ensuring the rigor of the peer review process, while also making every effort to ensure a fast review cycle to meet the needs of authors and the academic community. Secondly, the editorial team of the International Journal of Clinical Case Reports and Reviews is composed of a group of senior scholars and professionals with rich experience and professional knowledge in related fields. The editorial department is committed to assisting authors in improving their manuscripts, ensuring their academic accuracy, clarity, and completeness. Editors actively collaborate with authors, providing useful suggestions and feedback to promote the improvement and development of the manuscript. We believe that the support of the editorial department is one of the key factors in ensuring the quality of the journal. Finally, the International Journal of Clinical Case Reports and Reviews is renowned for its high- quality articles and strict academic standards. The editorial department is committed to publishing innovative and academically valuable research results to promote the development and progress of related fields. The International Journal of Clinical Case Reports and Reviews is reasonably priced and ensures excellent service and quality ratio, allowing authors to obtain high-level academic publishing opportunities in an affordable manner. I hereby solemnly declare that the International Journal of Clinical Case Reports and Reviews has a high level of credibility and superiority in terms of peer review process, editorial support, reasonable fees, and journal quality. Sincerely, Rui Tao.

img

Rui Tao

Clinical Cardiology and Cardiovascular Interventions I testity the covering of the peer review process, support from the editorial office, and quality of the journal.

img

Khurram Arshad

Clinical Cardiology and Cardiovascular Interventions, we deeply appreciate the interest shown in our work and its publication. It has been a true pleasure to collaborate with you. The peer review process, as well as the support provided by the editorial office, have been exceptional, and the quality of the journal is very high, which was a determining factor in our decision to publish with you.

img

Gomez Barriga Maria Dolores

The peer reviewers process is quick and effective, the supports from editorial office is excellent, the quality of journal is high. I would like to collabroate with Internatioanl journal of Clinical Case Reports and Reviews journal clinically in the future time.

img

Lin Shaw Chin

Clinical Cardiology and Cardiovascular Interventions, I would like to express my sincerest gratitude for the trust placed in our team for the publication in your journal. It has been a true pleasure to collaborate with you on this project. I am pleased to inform you that both the peer review process and the attention from the editorial coordination have been excellent. Your team has worked with dedication and professionalism to ensure that your publication meets the highest standards of quality. We are confident that this collaboration will result in mutual success, and we are eager to see the fruits of this shared effort.

img

Maria Dolores Gomez Barriga

Dear Dr. Jessica Magne, Editorial Coordinator 0f Clinical Cardiology and Cardiovascular Interventions, I hope this message finds you well. I want to express my utmost gratitude for your excellent work and for the dedication and speed in the publication process of my article titled "Navigating Innovation: Qualitative Insights on Using Technology for Health Education in Acute Coronary Syndrome Patients." I am very satisfied with the peer review process, the support from the editorial office, and the quality of the journal. I hope we can maintain our scientific relationship in the long term.

img

Dr Maria Dolores Gomez Barriga

Dear Monica Gissare, - Editorial Coordinator of Nutrition and Food Processing. ¨My testimony with you is truly professional, with a positive response regarding the follow-up of the article and its review, you took into account my qualities and the importance of the topic¨.

img

Dr Maria Regina Penchyna Nieto

Dear Dr. Jessica Magne, Editorial Coordinator 0f Clinical Cardiology and Cardiovascular Interventions, The review process for the article “The Handling of Anti-aggregants and Anticoagulants in the Oncologic Heart Patient Submitted to Surgery” was extremely rigorous and detailed. From the initial submission to the final acceptance, the editorial team at the “Journal of Clinical Cardiology and Cardiovascular Interventions” demonstrated a high level of professionalism and dedication. The reviewers provided constructive and detailed feedback, which was essential for improving the quality of our work. Communication was always clear and efficient, ensuring that all our questions were promptly addressed. The quality of the “Journal of Clinical Cardiology and Cardiovascular Interventions” is undeniable. It is a peer-reviewed, open-access publication dedicated exclusively to disseminating high-quality research in the field of clinical cardiology and cardiovascular interventions. The journal's impact factor is currently under evaluation, and it is indexed in reputable databases, which further reinforces its credibility and relevance in the scientific field. I highly recommend this journal to researchers looking for a reputable platform to publish their studies.

img

Dr Marcelo Flavio Gomes Jardim Filho

Dear Editorial Coordinator of the Journal of Nutrition and Food Processing! "I would like to thank the Journal of Nutrition and Food Processing for including and publishing my article. The peer review process was very quick, movement and precise. The Editorial Board has done an extremely conscientious job with much help, valuable comments and advices. I find the journal very valuable from a professional point of view, thank you very much for allowing me to be part of it and I would like to participate in the future!”

img

Zsuzsanna Bene