Research Article | DOI: https://doi.org/10.31579/2641-0419/388
1Centre for Cellular and Molecular Biology, Hyderabad, Telangana, India.
2Gandhi Medical College, Hyderabad, Telangana, India.
1,3University of Geneva Hospital, Geneva, Switzerland.
4Department of National Institute of Mental Health and Neurosciences, Bengaluru, India.
5Department of Experimental Medicine and Biotechnology, PGIMER, Chandigarh, India.
6Department of Genetics, Osmania University, Hyderabad, Telangana, India.
*Corresponding Author: Deepa Selvi Rani and Kumarasamy Thangaraj, Centre for Cellular and Molecular Biology, Uppal Road, Hyderabad-500 007, India.
Citation: Deepa S. Rani, Abhishek Thangaraj, Archana V. Kumar, Periyasamy Govindaraj, Madhu Khullar, et al, (2024), A Common 5bp (CTTCT) Deletion Polymorphism in TNNT2 is Significantly Associated with Hypertrophic Cardiomyopathy, J Clinical Cardiology and Cardiovascular Interventions, 7(8); DOI: 10.31579/2641-0419/388
Copyright: © 2024, Deepa Selvi Rani. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Received: 27 June 2024 | Accepted: 31 July 2024 | Published: 12 August 2024
Keywords: HCM; Hypertrophic Cardiomyopathy; 5bp polymorphism; TNNT2; allele frequency; genotype frequency
Troponin T is a component of the Troponin complex, which plays a major role in the regulation of myocardial contraction in response to changes in the intracellular Ca2+ion concentration. Deletion of 5bp (CTTCT) in the polypyrimidine tract of intron 3 of the cardiac Troponin T gene (TNNT2) results in cTnT2 and cTnT4 isoforms by skipping of exon 4, which was reported to be associated with hypertrophic cardiomyopathy (HCM). In the present study, we screened a common 5bp deletion polymorphism in TNNT2 gene using direct sequencing in 178 cardiomyopathy patients with significant LV hypertrophy from North India against 197 ethnically matched and clinically well-characterized healthy controls. Our study revealed a high frequency of del/del genotype in patients with HCM vs controls (p=0.000007). The deletion and insertion allele frequencies in patients and controls were (75% & 25%) and (56% & 44%), respectively. Further, analysis of 2056 caste and tribe groups belonging to highly diverse endogamous people inhabited in different states of India have revealed higher deletion allele frequency in both South and North Indian states compare to control group whereas the North-eastern states showed a slightly higher frequency of insertion allele. In conclusion, the deletion allele frequency in the HCM patient group is found to be significantly higher than the control group (p=<.0001). Therefore, the deletion allele frequency is not only associated with LV hypertrophy in Japanese, French, and South Indian HCM patients but also in North Indian HCM patients.
Studies have reported four isoforms of human cardiac Troponin T (cTnT) in myocardial muscle [1]. The cTnT3 (missing exon 5) is a major mRNA isoform of a normal adult heart and cTnT4 (missing exons 4 and 5) is a minor isoform and the cTnT1 (all exons present) and cTnT2 (missing exon 4) mRNAs isoforms are found to be expressed in a barely detectable quantity [2 3]. The four isoforms are reported to be a result of alternative splicing of a single gene Troponin T (TNNT2), which is located on chromosome 1q32 [4-7]. Farza et al have described the sequence and the organization of the TNNT2 gene and a possible mechanism by which some of the cTnT mRNA are generated [8].
In humans, pre-mRNA splicing involves the removal of introns and the ligation of the exons forming mature mRNA. Accurate removal of introns required several cis-acting sequences and trans-acting factors. The polypyrimidine tract is one of the important cis-acting sequence elements, which dictate the removal of the intron from pre-mRNA splicing. Deletion of 5bp (CTTCT) at the polypyrimidine tract in intron 3 of the TNNT2 gene AApolymorphism significantly affects the mRNA expression pattern by skipping exon 4 during splicing; it has been proved by in vitro mRNA (mini gene construct) expression study [11]. The missing exon 4 in cardiac Troponin T corresponding to isoforms cTnT2 and cTnT4, and the isoform cTnT4 have been reported in failing hearts [4 5]. The two isoforms cTnT2 and cTnT4 are found to be functionally distinct based on the structure, Ca2+ sensitivity, and inhibition of force development [1].
India is known for its genetic diversity, a high level of endogamy created by social boundaries within and between castes and tribes, along with the influence of evolutionary forces such as long-term isolation, fragmentation, and genetic drift has kept the Indian populations diverse and distant from each other [12 13]. Previously, we reported 5bp (del/del) polymorphism and its association in South Indian HCM cases [14]. In the present study, we screened the frequency of 5bp (del/del) polymorphism in North Indian Hypertrophic Cardiomyopathies (HCM).
Patients, controls, and population samples
A total of 178 unrelated cardiomyopathy patients with significant LV hypertrophy from North India were included in this study. All the patients fulfilled the selection criteria, based on electrocardiographic and echocardiographic measurements, without hypertension or the patient currently not on any anti-hypertensive medications were recruited from the Post Graduate Institute of Medical Education and Research (PGIMER), Chandigarh, India, (Table 1), along with one ninety-seven healthy normal individuals from the same ethnic background, without hypertension and cardiomyopathy as controls based on the electrocardiographic and echocardiographic measurements.
DNA isolation
DNA was isolated from the samples using the following protocol: Erythrocytes were lysed with 15.0 ml of erythrocyte lysis buffer for 5 minutes (10 mM Tris pH 8.0, 320 mM sucrose, 5 mM MgCl2, 1% Triton X-100; Sigma Chemical Company, St Louis, MO, USA). After complete lysis, the leukocytes were pelleted by centrifugation. The leukocyte pellet was dissolved in 8.0 ml of leukocyte lysis buffer (400 mM Tris, 60 mM EDTA, 150 mM NaCl, and 1% SDS; Sigma) and mixed thoroughly. To this, 2.0 ml of 5M sodium perchlorate (E. Merck, Darmstadt, Germany) was added and mixed thoroughly for 2–3 minutes. The DNA of both the patients and the controls was Precipitated by extracting once with phenol: chloroform, and again with chloroform. The precipitated DNA was then washed with 70% ethanol and dissolved in TE buffer (10 mM Tris pH 8.0, 1 mM EDTA).
PCR assay for 5bp (del/del; ins/del; ins/ins) Genotyping
A pair of primers to amplify the exons 3 and 4 of TNNT2gene, covering the exons and exon boundaries of TNNT2 were designed and synthesized using an ABI 392 Oligo synthesizer (Perkin-Elmer. Foster City. CA). The nucleotide sequence of both FP (forward primer) TNNT2: 3F = (5'atgagaacggcaggccaggctagtg 3') and the RP (reverse primer) TNNT2: 4R = (5’gtttgcctcaagacccgagcaacc 3’). PCR of each sample was set in a 0.2ml thin-wall tube using 5.0 ng of DNA, 10 pM of each primer, 200 mM of dNTPs, 1X PCR buffer containing 1.5 mM MgCl2 and 2U of AmpliTaq Gold (Perkin Elmer). The cycling conditions used for amplification are as follows: initial denaturation at 940C for 1 min followed by 30 cycles of denaturation for 45 sec at 940C, annealing for 40 sec at 580C, and extension for 37 sec at 700C (final extension for 7 min).
Sequencing of the PCR amplicon
The PCR amplicon was directly sequenced using 50.0 ng (2.0 ml) of PCR product and 2 pM (0.5ml) of primer, 2.0 ml of BigDye Terminator (v3.1) ready reaction mix (Perkin Elmer), and 0.5ml of double distilled water (DDW) to make up the volume to 5.0ml. The PCR cycle sequencing was carried out in a GeneAmp 9600 Thermal cycler (Perkin Elmer) employing the following conditions: 960C for 10 seconds, 550C for 5 seconds, and 600C for 4 minutes for 30 cycles. Extended products have been purified and dissolved in 10 ml of 50% Hi-Di formamide to analyze in an ABI 3730 Genetic Analyzer (Perkin Elmer, Foster City, CA, USA).
Statistical analysis
Chi-square χ2 test and odds ratio were carried out and obtained p-value to analyze (http://faculty.vassar.edu/lowry/VassarStats.html) the significance of the 5bp (D/D, I/D, I/I) polymorphism in HCM patients and controls of Indian origin.
In humans, myocardial TnT expression has been found to influence the disease pathogenesis and development. Studies have reported that the human myocardium has expressed in four TnT isoforms (Figure.1). In the present study, we screened a five bp (del/del) polymorphism in the TNNT2 gene (Figure.2) in 178 unrelated hypertrophy cardiomyopathy patients from North India (Table 1), against 197 ethnically matched and clinically well-characterized controls. We analysed the genotype and the allele frequencies in HCM patients from North India against controls (Tables 2 and 3). We found significantly higher del/del genotype (64%) and deletion allele (75%) frequencies in HCM patients (Tables 2 and 3). The frequencies of del/del; del/ins; ins/ins genotypes in the HCM patients were 64%, 22%, and 14 %, respectively (Table 2), whereas, in the control group, they were 41%, 30%, and 29%, respectively (Table 2). The del/del genotype frequency in the hypertrophy patients showed significantly higher P value (P=0.000007) than that of the control group (Table 2). The frequency of deletion and insertion alleles in patients were 75% and 25%, respectively (Table 3), whereas in the control group, they were 56% and 44%, respectively (Table 3). The deletion allele frequency in hypertrophic patient group was significantly higher than that of the control group (p=<.0001) (Table 3).

Table 1: Clinical features of Hypertrophic cardiomyopathy patients studied

Table 2: Genotype Frequency of a common 5bp Polymorphism (D/D, I/D, I/I) in TNNT2- Observed in Hypertrophic Cardiomyopathy Patients from North India

Table 3. Allele Frequency of a common 5bp Polymorphism (Deletion/Insertion) in TNNT2- Observed in Hypertrophic Cardiomyopathy Patients from North India
Further, analysis of 2056 caste and tribe groups belonging to highly diverse endogamous populations inhabited in different states of India has revealed their 5bp del/del polymorphism frequencies (Table 4). Interestingly, the frequency of del/del genotype was high in Beastha Chaurasia, Gamit, Jain Meena, Subba, and Great Andamanese as compared to the controls.
However, the insertion allele frequency found to be high in Nishi, Ao-Naga, Chakesang Naga, Mizo, Kandha, Sah, mixed people from West Bengal, Siddis from Gujarat and Karnataka, Medar from Karnataka and Onges of the Andaman Island (Table 4). Our study revealed a very high del/del genotype and deletion allele frequency in HCM (Table 2 and 3), compared to most of the diverse people from different states of India (Table 4).
The human myocardium has the potential to express multiple TnT isoforms. The major TnT isoforms expressed in the failing human heart are the products of alternative splicing of mRNA [15] (Figure.1), rather than post-translational modifications of a single protein or the result of proteolysis [4]. The basis of TnT isoform expression in chicken and rat [13] hearts and rabbit,[16] rat, [17] and avian [18] skeletal muscles are the result of alternative splicing

Table 4. Genotype and Allele frequency of a common 5bp (D/D, I/D, I/I) Polymorphism Detected in Caste and Tribe groups belonging to different states of India


(Figure.2). The C/T polymorphism in intronic polypyrimidine tract was found to influence splicing [19]. The polypyrimidine tract is one of the important cis-acting sequence elements directing intron removal in pre-mRNA splicing, however, the deletion of the polypyrimidine tract has been found to abolish correct lariat formation, spliceosome assembly, and thus the alternate splicing results in skipping of exon [7,8].
The 5bp (CTTCT) polymorphism in intron 3 of TNNT2 was reported to be in the polypyrimidine tract sequence which results in the skipping of exon 4, located downstream of this polymorphism [6,9]. Missing exon 4 in cardiac TNNT2 corresponds to isoforms cTnT2 and cTnT4, and found to be elevated in heart failure and the fetal heart [3-5]. The 5bp deletion polymorphism reported in the French population was found to be influencing the splicing accuracy and efficiency, although the clinical significance of this polymorphism has not been elucidated [6]. The minigene construct (in vitro mRNA expression) has shown that the 5bp deletion had affected the mRNA expression pattern by skipping of exon four cardiac TNNT2 [9].
We have therefore screened the 5bp (D/D, D/I, I/I) polymorphism in the intron 3 of the TNNT2 gene in North Indian HCM patients and found that the deletion (del/del) genotype and the deletion allele frequencies were significantly higher in the hypertrophic cases, compared to the healthy controls. Hence, the del/del genotype (73%) might be associated with prominent concentric LV hypertrophy in such cases. The difference in deletion allele frequencies between the patients (HCM) and healthy controls has shown a statistically significant p-value (p=0.000172).
In Japanese patients, the frequency of insertion and deletion alleles in the HCM was 33.1 and 66.9%, respectively [9]. Our study revealed that the del/del genotype frequency in North Indians are 75% higher than that of the Japanese patients, suggesting a strong association. This indicates that the 5bp del/del genotype and the deletion alleles of Troponin T2 are associated with a predisposition to prominent left ventricular hypertrophy not only in French, Japanese, and South Indian patients but also in North Indian HCM patients.
Most Indians descend from a mixture of two genetically divergent populations: Ancestral North Indians (ANI) and Ancestral South Indians (ASI)[10]. Our study of 2056 Caste and Tribe groups belonging to highly diverse endogamous populations inhabited in different states of India showed that the frequency of 5bp (del/del) polymorphism was significantly higher not only in South Indians but also in North Indians (p=0.000535). Therefore, our study helps to understand the frequency of 5bp (del/del) polymorphism in the admixture of the Indian population. In conclusion, the TNNT2 del/del genotype and the deletion allele frequency are not only associated with LV hypertrophy in Japanese, French, and South Indian hypertrophic cardiomyopathy but also in HCM patients from North India.
We thank all the volunteers (hypertrophic cardiomyopathy patients and healthy controls) who donated their blood samples for this study.
The authors have declared that there is no conflict of interest exist.
D. S. Rani is salaried through CSIR_CCMB, Hyderabad, India. CSIR/CCMB funded this project. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
It was my pleasure to submit my testimonial concerning the Reviewer Board of our Scientific Journal “Brain and Neurological Disorders”. The Reviewers focused on some modifications and their contribution was helpful. The ladies of our Editorial Office were also supported my efforts. It was my honor to have such a co-operation and I am looking forward for more collaboration.
Dear Grace Pierce, Editorial Coordinator of Journal of Clinical Research and Reports, Thank you for the speedy and efficient peer review process. I appreciate the fact that your peer reviewers do not take months to respond like with some other journals. I would also like to thank the editorial office for responding quickly to my questions. It is an excellent journal. I plan to submit more manuscripts in the future. Best wishes from, Robert W. McGee
Dear Grace Pierce, Editorial Coordinator of Journal of Clinical Research and Reports, Working with you and your team on our recent publication in JCRR has been a truly wonderful and enjoyable experience. The responses were prompt, and the reviewers were patient, constructive, and highly professional. One reviewer in particular gave me the feeling that a professor was carefully reading and commenting on my coursework, which was deeply touching. The entire process was straightforward and hassle‑free, with no tedious online forms to complete. I highly recommend this journal. Best wishes from, DR Aibing Rao, Head of R&D
I Appreciate the Opportunity to Share my Experience with the Journal of Clinical Research and Reports. The peer review process was timely and constructive, and the feedback provided helped improve the quality of our manuscript. The editorial office was professional, responsive, and supportive throughout the process, ensuring smooth communication and efficient handling of the submission. Overall, it was a positive experience collaborating with your team.
Dear Mercy Grace, Editorial Coordinator of Obstetrics Gynecology and Reproductive Sciences, We would like to express our gratitude for your help at all stages of publishing and editing the article. The editors of the magazine answer all the necessary questions and help at every stage. We will definitely continue to cooperate and publish other works in the Obstetrics Gynecology and Reproductive Sciences! Best wishes from, Alla Konstantinovna Politova,
Dear Maria Emerson, Editorial Coordinator of International Journal of Clinical Case Reports and Reviews, What distinguishes International Journal of Clinical Case Report and Review is not only the scientific rigor of its publications, but the intellectual climate in which research is evaluated. The submission process is refreshingly free of unnecessary formal barriers and bureaucratic rituals that often complicate academic publishing without adding real value. The peer-review system is demanding yet constructive, guided by genuine scientific dialogue rather than hierarchical or authoritarian attitudes. Reviewers act as collaborators in improving the manuscript, not as gatekeepers imposing arbitrary standards. This journal offers a rare balance: high methodological standards combined with a respectful, transparent, and supportive editorial approach. In an era where publishing can feel more burdensome than research itself, this platform restores the original purpose of peer review — to refine ideas, not to obstruct them Prof. Perlat Kapisyzi, FCCP PULMONOLOGIST AND THORACIC IMAGING.